Anhedonia induced by high-fat diet in mice depends on gut microbiota and leptin.

Objectives: Imbalanced nutrition and obesity are risk factors for depression, a relationship that in rodents can be modeled by depression-like behavior in response to high-fat diet (HFD). In this work, we examined the role of the intestinal microbiota and the adipocytokine leptin as potential mediators of the effects of HFD to induce anhedonia-like behavior and reduce self-care in mice.Methods: Male mice were fed a control diet or HFD (60 kJ% from fat) for a period of 4 weeks, after which behavioral tests and molecular analyses (gut microbiome composition, intestinal metabolome, fecal fatty acids, plasma hormone levels) were performed. The role of the intestinal microbiota was addressed by selective depletion of gut bacteria with a combination of non-absorbable antibiotics, while the implication of leptin was examined by the use of leptin-deficient ob/ob mice.Results: Antibiotic treatment reduced the HFD-induced weight gain and adiposity and prevented HFD-induced anhedonia-like behavior and self-care reduction. These effects were associated with a decrease in fecal fatty acids and intestinal microbiota-related metabolites including short-chain fatty acids, glucose and amino acids. Gut microbiota depletion suppressed the HFD-induced rise of plasma leptin, and the circulating leptin levels correlated with the anhedonia-like behavior and reduced self-care caused by HFD. The anhedonic effect of HFD was absent in leptin-deficient ob/ob mice although these animals gained more weight and adiposity in response to HFD than wild-type mice.Discussion: The results indicate that anhedonia-like behavior induced by HFD in mice depends on the intestinal microbiome and involves leptin as a signaling hormone.

Lack of peptide YY signaling in mice disturbs gut microbiome composition in response to high-fat diet.

Peptide YY (PYY), produced by endocrine L cells in the gut, is known for its critical role in regulating gastrointestinal functions as well as satiety. However, how these processes are integrated with maintaining a healthy gut microbiome composition is unknown. Here, we show that lack of PYY in mice leads to distinct changes in gut microbiome composition that are diet-dependent. While under chow diet only slight differences in gut microbiome composition could be observed, high-fat diet (HFD) aggravated these differences. Specifically an increased abundance of the Bacteroidetes phylum with a corresponding decrease of the Firmicutes/Bacteroidetes ratio could be detected in Pyy-knockout (KO) mice in response to HFD. Detailed analysis of the Bacteroidetes phylum further revealed that the Alistipes genus belonging to the Rikenellaceae family, the Parabacteroides belonging to the Tannerellaceae family, as well as Muribaculum were increased in Pyy-KO mice. In order to investigate whether these changes are associated with changed markers of gut barrier and immunity, we analyzed the colonic expression of various pro-inflammatory cytokines, as well as tight junction proteins and mucin 2, and identified increased mRNA expression of the tight junction proteins Cldn2 and Ocel1 in Pyy-KO mice, while pro-inflammatory cytokine expression was not significantly altered. Together these results highlight a critical gene-environment interaction between diet and the gut microbiome and its impact on homeostasis of the intestinal epithelium under conditions of reduced PYY signaling which is commonly seen under obese conditions.

Synergistic and antagonistic interactions between antibiotics and synbiotics in modifying the murine fecal microbiome.

PURPOSE: Pro- and synbiotics have been reported to ameliorate the adverse (dysbiotic) effects of antibiotics on the gut microbial architecture, but little is known how synbiotics and antibiotics interact with each other in shaping the gut microbiota. To explore this mutual interaction we examined, first, the effect of a multi-strain synbiotic on antibiotic-induced dysbiosis and, second, the dysbiotic effect of antibiotics followed by prolonged synbiotic exposure. METHODS: The synbiotic containing nine bacterial strains was administered to male mice via the drinking water, while the antibiotic mix containing bacitracin, meropenem, neomycin, and vancomycin was administered via oral gavage. Two experimental protocols were used. In protocol 1, mice were administered placebo or synbiotic for 3 weeks prior to and during an 11-day vehicle or antibiotic treatment. In protocol 2 the synbiotic was administered for a prolonged period of time, starting 3 weeks prior and continuing for 12 weeks after an 11-day vehicle or antibiotic treatment. Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s_515_S3_fwd: GATTGCCAGCAGCCGCGGTAA and 16s_806_S2_rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. The final sequence files were analyzed by QIIME 1.8 workflow scripts. RESULTS: Antibiotic treatment markedly decreased the bacterial richness and diversity of the fecal microbiota. Synbiotic administration for 3 weeks prior to and during an 11-day antibiotic treatment preserved the Lactobacillales and expanded the Verrucomicrobiales and Bifidobacteriales order, but did not prevent the depletion of Bacteroidales and the short-term proliferation of Enterobacteriales. When the synbiotic administration was continued for 12 weeks after the end of antibiotic treatment, the rise of Verrucomicrobiales was maintained, whereas the preservation of Lactobacillales and boost of Bifidobacteriales was lost. The abundance of Clostridiales was enhanced by long-term synbiotic treatment after short-term exposure to antibiotics, while the antibiotic-depleted Bacteroidales underwent a delayed recovery. CONCLUSIONS: There are complex synergistic and antagonistic interactions of synbiotics and antibiotics in influencing distinct bacterial orders of the fecal microbiota. The impact of a short-term antibiotic exposure is profoundly different when analyzed after synbiotic pretreatment or following prolonged synbiotic administration in the post-antibiotic period.

Experimental colitis reduces microglial cell activation in the mouse brain without affecting microglial cell numbers.

Inflammatory bowel disease (IBD) patients frequently suffer from anxiety disorders and depression, indicating that altered gut-brain axis signalling during gastrointestinal inflammation is a risk factor for psychiatric disease. Microglia, immune cells of the brain, is thought to be involved in a number of mental disorders, but their role in IBD is largely unknown. In the current work, we investigated whether colitis induced by dextran sulphate sodium (DSS), a murine model of IBD, alters microglial phenotypes in the brain. We found that colitis caused a reduction of Iba-1 and CD68 immunoreactivity, microglial activation markers, in specific brain regions of the limbic system such as the medial prefrontal cortex (mPFC), while other areas remained unaffected. Flow cytometry showed an increase of monocyte-derived macrophages during colitis and gene expression analysis in the mPFC showed pronounced changes of microglial markers including cluster of differentiation 86 (CD86), tumour necrosis factor-α, nitric oxide synthase 2, CD206 and chitinase-like protein 3 consistent with both M1 and M2 activation. Taken together, these findings suggest that experimental colitis-induced inflammation is propagated to the brain altering microglial function.

Intranasal Neuropeptide Y Blunts Lipopolysaccharide-Evoked Sickness Behavior but Not the Immune Response in Mice.

Neuropeptide Y (NPY) has been demonstrated to exert stress buffering effects and promote resilience. Non-invasive intranasal (IN) application of NPY to rodents is able to mitigate traumatic stress-induced behavioral changes as well as dysfunction of the hypothalamic-pituitary-adrenal (HPA) axis. However, it is unknown whether IN NPY could prevent the behavioral, pro-inflammatory and neurochemical responses to peripheral immune activation by the Toll-like receptor 4 (TLR4) stimulant lipopolysaccharide (LPS). Therefore, we analyzed the effects of IN NPY (100 µg) on the behavioral sickness response (reduced locomotion and exploration) and the underlying molecular mechanisms, 3 h and 21 h after intraperitoneal injections of LPS (0.03 mg/kg) in male C57BL/6N mice. The acute behavioral sickness response was significantly dampened by pretreatment with IN NPY 3 h after LPS injection. This effect was accompanied by diminished weight loss and lowered plasma corticosterone (CORT) levels 21 h after LPS injection. In contrast, acute circulating cytokine levels and hypothalamic cytokine mRNA expression remained unaltered by IN NPY, which indicates that the peripheral and cerebral immune response to LPS was left undisturbed. Our findings are in agreement with the reported activity of NPY to dampen the response of the HPA axis to stress. We propose that IN NPY ablates sickness behavior at a site beyond the peripheral and cerebral cytokine response, an action that is associated with reduced activity of the HPA axis as determined by decreased plasma CORT.These results indicate that IN NPY administration may be relevant to the management of neuropsychiatric disorders arising from immune-induced neuroendocrine dysfunction.

Intermittent Fasting Exacerbates the Acute Immune and Behavioral Sickness Response to the Viral Mimic Poly(I:C) in Mice.

Intermitted fasting and other forms of calorie restriction are increasingly demonstrated to exert potential health benefits. Interestingly, restricted feeding is also able to mitigate sickness in response to bacterial factors stimulating Toll-like receptor 4 (TLR4). However, little is known about how fasting modifies the activity of virus-associated molecular patterns. We therefore analyzed the impact of an intermittent fasting (IF) regimen on the immune and behavioral response to the TLR3 agonist and viral mimic polyinosinic:polycytidylic acid [Poly(I:C)] in mice. The effects of intraperitoneally injected Poly(I:C) (12 mg/kg) on plasma and cerebral cytokine expression and behavior (locomotion, exploration, and ingestion) were examined in male C57BL/6N mice under control conditions and following a 9 days period of intermittent (alternate day) fasting (IF). Poly(I:C) increased the circulating levels of cytokines (TNF-α, MCP-1, IL-6, IL-10, IFN-α, IFN-γ), an effect amplified by IF. In addition, IF aggravated sickness behavior in response to Poly(I:C), while cerebral cytokine expression was enhanced by application of Poly(I:C) in the absence of a significant effect of IF. Furthermore, IF augmented the expression of neuropeptide Y (NPY) mRNA in the hypothalamus and increased the plasma levels of corticosterone, while Poly(I:C) had little effect on these readouts. Our data show that IF does not abate, but exaggerates the immune and sickness response to the viral mimic Poly(I:C). This adverse effect of IF occurs despite increased hypothalamic NPY expression and enhanced plasma corticosterone. We therefore propose that the effects of IF on the immune and behavioral responses to viral and bacterial factors are subject to different neuronal and neuroendocrine control mechanisms.

Diabesity and mood disorders: Multiple links through the microbiota-gut-brain axis.

The global prevalence of diabesity is on the rise, and the clinical, social and economic health burden arising from this epidemic is aggravated by a significant co-morbidity of diabesity with neuropsychiatric disease, particularly depression. Importantly, not only is the prevalence of mood disorders elevated in patients with type 2 diabetes, depressed patients are also more prone to develop diabetes. This reciprocal relationship calls for a molecular and systemic analysis of diabesity-brain interactions to guide preventive and therapeutic strategies. The analysis we are presenting in this review is modelled on the microbiota-gut-brain axis, which provides the brain with information from the gut not only via the nervous system, but also via a continuous stream of microbial, endocrine, metabolic and immune messages. This communication network offers important clues as to how obesity and diabetes could target the brain to provoke neuropsychiatric disease. There is emerging evidence that the gut microbiota is orchestrating a multiplicity of bodily functions that are intimately related to the immune, metabolic and nervous systems and that gut dysbiosis spoils the homeostasis between these systems. In our article we highlight two groups of molecular links that seem to have a significant bearing on the impact of diabesity on the brain. On the one hand, we focus on microbiota-related metabolites such as short-chain fatty acids, tryptophan metabolites, immune stimulants and endocannabinoids that are likely to play a mediator role. On the other hand, we discuss signalling molecules that operate primarily in the brain, specifically neuropeptide Y, brain-derived neurotrophic factor and γ-amino butyric acid, that are disturbed by microbial factors, obesity and diabetes and are relevant to mental illness. Finally, we address the usefulness of diet-related interventions to suspend the deleterious relationship between diabesity and mood disorders.

Visceral Inflammation and Immune Activation Stress the Brain.

Stress refers to a dynamic process in which the homeostasis of an organism is challenged, the outcome depending on the type, severity, and duration of stressors involved, the stress responses triggered, and the stress resilience of the organism. Importantly, the relationship between stress and the immune system is bidirectional, as not only stressors have an impact on immune function, but alterations in immune function themselves can elicit stress responses. Such bidirectional interactions have been prominently identified to occur in the gastrointestinal tract in which there is a close cross-talk between the gut microbiota and the local immune system, governed by the permeability of the intestinal mucosa. External stressors disturb the homeostasis between microbiota and gut, these disturbances being signaled to the brain via multiple communication pathways constituting the gut-brain axis, ultimately eliciting stress responses and perturbations of brain function. In view of these relationships, the present article sets out to highlight some of the interactions between peripheral immune activation, especially in the visceral system, and brain function, behavior, and stress coping. These issues are exemplified by the way through which the intestinal microbiota as well as microbe-associated molecular patterns including lipopolysaccharide communicate with the immune system and brain, and the mechanisms whereby overt inflammation in the GI tract impacts on emotional-affective behavior, pain sensitivity, and stress coping. The interactions between the peripheral immune system and the brain take place along the gut-brain axis, the major communication pathways of which comprise microbial metabolites, gut hormones, immune mediators, and sensory neurons. Through these signaling systems, several transmitter and neuropeptide systems within the brain are altered under conditions of peripheral immune stress, enabling adaptive processes related to stress coping and resilience to take place. These aspects of the impact of immune stress on molecular and behavioral processes in the brain have a bearing on several disturbances of mental health and highlight novel opportunities of therapeutic intervention.